Some scientists are saying the things Iāve been saying about meaning being a fundamental property of the universe 
āInformation itself might be a vital parameter of the cosmos, similar to mass, charge and energy.ā
-Michael Wong, Carnegie Institution
#astrobiology #incompleteness #noncomputability life
https://www.mdpi.com/2075-1729/12/6/783
We are embarking on a new age of astrobiology, one in which numerous interplanetary missions and telescopes will be designed, built, and launched with the explicit goal of finding evidence for life beyond Earth. Such a profound aim warrants caution and responsibility when interpreting and disseminating results. Scientists must take care not to overstate (or over-imply) confidence in life detection when evidence is lacking, or only incremental advances have been made. Recently, there has been a call for the community to create standards of evidence for the detection and reporting of biosignatures. In this perspective, we wish to highlight a critical but often understated element to the discussion of biosignatures: Life detection studies are deeply entwined with and rely upon our (often preconceived) notions of what life is, the origins of life, and habitability. Where biosignatures are concerned, these three highly related questions are frequently relegated to a low priority, assumed to be already solved or irrelevant to the question of life detection. Therefore, our aim is to bring to the fore how these other major astrobiological frontiers are central to searching for life elsewhere and encourage astrobiologists to embrace the reality that all of these science questions are interrelated and must be furthered together rather than separately. Finally, in an effort to be more inclusive of life as we do not know it, we propose tentative criteria for a more general and expansive characterization of habitability that we call genesity.
Gonna go to this free talk next Thursday evening
Symmetry (as transformationā¦ )
Where does representation meet reality ?
one thing I wonder about science is how it deals with the possibility that central aspects of our reality are composed of phenomena/forces/other things whose existence is unprovable & unfalsifiable
obv this is true of our social reality but Iām not sure you can so clearly delineate between the social and material.
You would love Roy Bhaskar 
I approach science from an Islamic perspective - I had people argue with me at uni because I said that as someone studying Microbiology, it strengthened my faith rather than made me doubt it. The Quran (over 1400 years old) mentions concepts in science that people werenāt aware of then but are accepted now (eg the universe expanding from a single and then collapsing at its end back to a single point, stages of embryonic development). Also learning about microbes meant learning about food chains in the most hostile environments in the world (like deep sea thermal vents where sulphur fixing bacteria form the bottom of food chains) which imo shows how complex and perfect and non accidental our planet is. Same with viruses, how something as tiny as a herpesvirus (like a baloon to the earth in relation to our bodies) can lie dormant and cause the chaos it does, or how HIV zips itself into our DNA, itās crazy. Also faith means knowing and happily accepting how huge human limitations are and how little we know and how much we may never know, and this makes the pursuit of knowledge and understanding of our reality a lot more straightforward imo
I would like to. not sure if this is for the science thread exactly but my current fixation is on thoughts, and on the possibility of a thought- or information-field. I think itās kinda interesting that thoughts are one of the most central aspects of our universe, but (as far as I know, and tbf Iām pretty ignorant) science only really seems to satisfy itself with describing the physical process of their creation.
There are many different working definitions of life; our goal here is not to advocate for one over another. (Indeed, we would argue that, given our present state of ignorance, all definitions thus far are actually tentative criteria for life that must be updated as knowledge advances.)
Been saying this for years, since taking an prebiotic life module at uni. I donāt have the right philosophical vocabulary to express this properly, but itās always seemed clear to me that definitions of ālifeā have been focused on finding common properties of what we currently accept as life, and then pushing at the edges a wee bit to test the boundaries (e.g. viruses), and then expressing that as being the definition of ālifeā. But it then gets taken as being the underlying property being observed, rather than what it really is, which is a circle drawn around what weāve already observed and categorised.
It doesnāt make sense to then take that definition and apply it to the unknown (or previously unobserved), like astrobiology, and then say something is or isnāt ālifeā within that definition. If you find something outside of that, but with some of the properties youāve previously used as indicators for life, then all you can say is that it either fits inside the set of data youāve already observed, or if it doesnāt. Going further than that and saying āthis therefore does/does not contain that intrinsic property called lifeā is daft.
e.g. you define life as being something having properties A, B, and C, based on what youāve observed so far on Earth.
You then observe something having properties A, B, and D. You can conclude that this is ānot lifeā, or you can redefine ālifeā to mean āmust have A and B and at least one of C or Dā. I think the first approach is usually applied and I donāt think that necessarily makes sense.
possibly links back to the op
if we just look at thoughts/consciousness in āphysicalistā terms it doesnt really explain what they are and how they are possible as something that is material-semiotic, not just material
but if information/meaning is somehow on a par with e.g., energy then a āphysicalistā understanding of thoughts could āmeanā so much more.
by physicalist I mean Physicalism (Stanford Encyclopedia of Philosophy)
maybe a limit/property of language too?
I kinda canāt believe how much absolutely crazy stuff theoretical physics covers, why are they not telling us all about it all the time
I maybe didnāt understand the op properly, Iāll need to watch a video or have it explained to me like a baby cos it sounds interesting but I felt like I was missing something, like all it was saying was that structures that are more durable for current conditions are more likely to thrive, and more durable structures tend to be more complex, in contradiction to the concept of entropy
Yeah I only understand a fraction of it but the bits I did understand just struck me as so intuitive
The Quanta article is an even more gratifying read!
I was always frustrated by disciplinary blinkers when discussing astrobiology/origin of life stuff in particular. For example, the idea of ājunk DNAā - the idea that non-coding sections of DNA were useless or vestigial or something - was always preposterous to me. It comes from viewing DNA as being a purely informational system, in a biological context, whereas in addition to that functionality itās also just a very big molecule and has the same properties that other molecules have - they take up space, they have a surface, they have electrical properties that vary across the molecule, they have a shape, they affect the solubility and polarisability of the macromolecular structure, etc etc etc.
So a non-coding/ājunkā region can have fundamentally important properties - maybe itās arranging the coding regions in space to interact with other bits of biochemical machinery? Maybe itās a big area of amphoteric moieties that can be regulated to change the net charge of the whole molecule, thus changing its binding affinity with other molecules or its relative solubility, or all the other consequences of chemical properties of a molecule when you stop thinking of it as just being a four-letter code. And it turns out that, yes, this is in fact the case.
And that seems so obvious to me! Evolutionary processes arenāt perfect and their outcomes are usually just about good enough to function, but the ājunk DNAā framing would mean that nearly half of the content of DNA is useless and as no function. Sense check that for a second: is evolution going to produce a system that is so wildly inefficient that it needs 50% more resources (in synthesising and replicating the ājunk DNAā regions) than one that doesnāt? Of course it isnāt! Of course itās not going to be functionally useless!
This is a bit over my head but from what I can follow, super interesting
Went on a guided tour of the World Museum Liverpoolās physical sciences collection on Monday and got to look at some behind the scenes stuff including loads of amateur astronomy results done by Scousers in the late 19th and early 20th century. Pictured is a photo I took of the full absorption spectrum of the Sunās light, recorded by this guy in Toxteth just for a laugh. It was really interesting!
Got carried away with my boasting rant 
Like, if you write it out the sequence of two different sections of DNA and the first is
AGCCCGATGTCCAGTTCGTTCC
and the second is
CCCCCCCCCCCCCCCCCCCCCC
then under the ājunk DNAā paradigm, you say that the first section is clearly important, because it contains ācodonsā that we know are used for the cell machinery to read and make specific amino acids, that are then assembled into proteins. The core informational flow of biochemistry.
And you look at the second one and go āthe fuck is that? Doesnāt code for anything, doesnāt fit into the core informational flow of biochemistry, must be junkā
But itās not just āCā. Another depiction of it is:
ā¦ which any chemist will see and understand that a chain of those linked together have a whole heap of properties that can convey functionality, because itās not ājustā a subunit of genetic code.
I wouldnāt say itās contradictory to entropy. Talking about entropy in the context of the origin of life is one of those rhetorical traps intelligent design folk like to use, because how can all these molecules become more organised over time when entropy says the opposite?
Because an organism isnāt a closed system. Look up, thereās a fucking giant ball of flaming gas bombarding the organism with energy (enthalpy) constantly. The organism is an entropy trap.
Conceptually, I think itās more akin to taking the idea of the flow of linear time as being the direction in which overall entropy increases, and saying that another way to define it is to say itās the direction in which overall functionality increases in a given system.
